Stem-loop sequence dme-mir-263b

Accession MI0000383
Description Drosophila melanogaster miR-263b stem-loop
Gene family MIPF0000122; mir-263
Stem-loop 
uu    -ac       c        g g     u     -u   c 
  gcug   uuugagu uuggcacu g agaau cacag  uga u
  ||||   ||||||| |||||||| | ||||| |||||  ||| u
  cggc   aaauuca aaccgugg c ucuug guguc  auu u
uu    caa       a        g g     -     uu   a
Get sequence
Deep sequencing
reads, experiments
Comments

miR-263b was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the ends of the excised miRNA by cloning. The sequence is localised to chromosome 3L.

Genome context
Coordinates (BDGP5.0) Overlapping transcripts
3L: 15836506-15836595 [-]
sense
FBtr0075534 ; CG32150-RB; intron 1
FBtr0075535 ; CG32150-RA; intron 1
FBtr0306853 ; CG32150-RD; intron 1
FBtr0075534 ; CG32150-RB; intron 1
FBtr0306852 ; CG32150-RC; intron 1
FBtr0075535 ; CG32150-RA; intron 1
FBtr0306853 ; CG32150-RD; intron 1
FBtr0075534 ; CG32150-RB; intron 1
FBtr0306852 ; CG32150-RC; intron 1
FBtr0075535 ; CG32150-RA; intron 1

Mature sequence dme-miR-263b-5p

Accession MIMAT0000362
Previous IDs dme-miR-263b
Sequence

16 -  

cuuggcacugggagaauucac

 - 36

Get sequence
Evidence experimental; cloned [2], 454 [3-4], Solexa [4]
Predicted targets

Mature sequence dme-miR-263b-3p

Accession MIMAT0020822
Sequence

55 -  

gugguucugcgggugccaaaac

 - 76

Get sequence
Evidence not experimental
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).