Stem-loop sequence dme-mir-87

AccessionMI0000382 (change log)
DescriptionDrosophila melanogaster miR-87 stem-loop
Gene family MIPF0000152; mir-87
Literature search

6 open access papers mention dme-mir-87
(9 sentences)

Stem-loop
   -----          auu        -u  c     g     ------cu   a 
5'      aacacauuuc   cgcgccug  au uugcu aaccg        gcc u
        ||||||||||   ||||||||  || ||||| |||||        ||| u
3'      uuguguaaag   guguggac  ua aacga uuggc        cgg a
   acgau          agu        uu  a     g     cuagcaac   u 
Get sequence
Deep sequencing
38591 reads, 396 reads per million, 45 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 9950418-9950516 [-]
intergenic
Database links

Mature sequence dme-miR-87-5p

Accession MIMAT0020821
Sequence

13 - 

ucgcgccuguaucuugcugaac

 - 34

Get sequence
Deep sequencing1824 reads, 36 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-87-3p

Accession MIMAT0000361
Previous IDsdme-miR-87
Sequence

61 - 

uugagcaaaauuucagguguguga

 - 84

Get sequence
Deep sequencing36752 reads, 44 experiments
Evidence experimental; Northern [1-2], 454 [4-5], Illumina [5]
Database links
Predicted targets

References

1
2
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).