Stem-loop sequence dme-mir-286

AccessionMI0000380 (change log)
DescriptionDrosophila melanogaster miR-286 stem-loop
Gene family MIPF0000225; mir-286
Literature search

8 open access papers mention dme-mir-286
(27 sentences)

Stem-loop
   ---         aaug    a   -    a     ucuuuuucaaagaaag 
5'    uuaaaauug    gcga ugu cggu ugguc                g
      |||||||||    |||| ||| |||| |||||                 
3'    aauuuuaau    ugcu aca gcca aucag                u
   uaa         aucg    c   a    g     ugaagcgaauuagcuu 
Get sequence
Deep sequencing
132240 reads, 4.43e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-286 was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the 5' end of the excised miRNA by cloning and reported a length distribution of 22-24 nt with 23 nt the most commonly expressed.

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 19661422-19661521 [-]
intergenic
Clustered miRNAs
< 10kb from dme-mir-286
dme-mir-309chr2R: 19661706-19661774 [-]
dme-mir-3chr2R: 19661595-19661663 [-]
dme-mir-286chr2R: 19661422-19661521 [-]
dme-mir-4chr2R: 19661289-19661369 [-]
dme-mir-5chr2R: 19661158-19661226 [-]
dme-mir-6-1chr2R: 19661003-19661084 [-]
dme-mir-6-2chr2R: 19660869-19660942 [-]
dme-mir-6-3chr2R: 19660716-19660795 [-]
Database links

Mature sequence dme-miR-286-5p

Accession MIMAT0020820
Sequence

13 - 

ggcgaaugucgguauggucucu

 - 34

Get sequence
Deep sequencing13242 reads, 34 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-286-3p

Accession MIMAT0000359
Previous IDsdme-miR-286
Sequence

65 - 

ugacuagaccgaacacucgugcu

 - 87

Get sequence
Deep sequencing118983 reads, 49 experiments
Evidence experimental; Northern [1], cloned [2], 454 [3-4], Illumina [4]
Database links
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).