Stem-loop sequence dme-mir-92b

AccessionMI0000379 (change log)
DescriptionDrosophila melanogaster miR-92b stem-loop
Gene family MIPF0000013; mir-25
Literature search

17 open access papers mention dme-mir-92b
(245 sentences)

Stem-loop
   ---uaaaa  u   cu a         u c c     uu      --ug au 
5'         cg cac  g uguaggccg g c agugc  auuugu    c  u
           || |||  | ||||||||| | | |||||  ||||||    |   
3'         gc gug  u acguccggc c g ucacg  uaaaca    g  u
   cagcugac  u   ag a         c u a     -u      uaaa cu 
Get sequence
Deep sequencing
476514 reads, 4.97e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-92b was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the ends of the excised miRNA by cloning.

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 25651398-25651497 [+]
intergenic
Clustered miRNAs
< 10kb from dme-mir-92b
dme-mir-92achr3R: 25646506-25646600 [+]
dme-mir-92bchr3R: 25651398-25651497 [+]
Database links

Mature sequence dme-miR-92b-5p

Accession MIMAT0020819
Sequence

19 - 

aggccgugcccagugcuuauuug

 - 41

Get sequence
Deep sequencing2736 reads, 27 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-92b-3p

Accession MIMAT0000358
Previous IDsdme-miR-92b
Sequence

60 - 

aauugcacuagucccggccugc

 - 81

Get sequence
Deep sequencing473684 reads, 49 experiments
Evidence experimental; Northern [1,3], cloned [2], 454 [4-5], Illumina [5]
Database links
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).