Stem-loop sequence dme-mir-100

Accession MI0000378
Description Drosophila melanogaster miR-100 stem-loop
Gene family MIPF0000025; mir-99
Stem-loop 
-------------------c    a     aa       au   aa      - u uuu 
                    cauu acaga  cccguaa  ccg  cuugug c g   u
                    |||| |||||  |||||||  |||  |||||| | |    
                    guaa ugucu  ggguauu  ggc  gaacau g c   a
acgguuuuuggucaacaaac    c     ga       ac   ca      u u uau
Get sequence
Deep sequencing
11440 reads, 47 experiments
Comments

miR-100 was reported independently by three groups using computational prediction [2], Northern blot analysis [1] and cloning [3]. References [1] and [2] confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [3] confirmed the ends of the excised miRNA by cloning. The sequence is localised to chromosome 2L.

Genome context
Coordinates (BDGP5.0) Overlapping transcripts
2L: 18471434-18471533 [+]
sense
FBtr0306973 ; CR43344-RA; exon 2
FBtr0306973 ; CR43344-RA; exon 2
Clustered miRNAs
< 10kb from dme-mir-100
dme-mir-100 2L: 18471434-18471533 [+]
dme-let-7 2L: 18472034-18472111 [+]
dme-mir-125 2L: 18472315-18472424 [+]

Mature sequence dme-miR-100-5p

Accession MIMAT0000357
Previous IDs dme-miR-100
Sequence

12 -  

aacccguaaauccgaacuugug

 - 33

Get sequence
Deep sequencing 10869 reads, 45 experiments
Evidence experimental; Northern [1,3], 454 [4-5], Solexa [5]
Predicted targets

Mature sequence dme-miR-100-3p

Accession MIMAT0020818
Sequence

51 -  

caagaccggcauuaugggaguc

 - 72

Get sequence
Deep sequencing 570 reads, 29 experiments
Evidence not experimental
Predicted targets

References

1
PMID:12812784 "Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity" Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V Dev Biol. 259:9-18(2003).
2
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
3
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).