Stem-loop sequence dme-mir-100

AccessionMI0000378 (change log)
DescriptionDrosophila melanogaster miR-100 stem-loop
Gene family MIPF0000033; mir-10
Literature search

18 open access papers mention dme-mir-100
(82 sentences)

Stem-loop
   -------------------c    a     aa       au   aa      - u uuu 
5'                     cauu acaga  cccguaa  ccg  cuugug c g   u
                       |||| |||||  |||||||  |||  |||||| | |    
3'                     guaa ugucu  ggguauu  ggc  gaacau g c   a
   acgguuuuuggucaacaaac    c     ga       ac   ca      u u uau 
Get sequence
Deep sequencing
14632 reads, 198 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-100 was reported independently by three groups using computational prediction [2], Northern blot analysis [1] and cloning [3]. References [1] and [2] confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [3] confirmed the ends of the excised miRNA by cloning.

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 18471434-18471533 [+]
sense
FBtr0306973 ; CR43344-RA; exon 2
Clustered miRNAs
< 10kb from dme-mir-100
dme-mir-100chr2L: 18471434-18471533 [+]
dme-let-7chr2L: 18472034-18472111 [+]
dme-mir-125chr2L: 18472315-18472424 [+]
Database links

Mature sequence dme-miR-100-5p

Accession MIMAT0000357
Previous IDsdme-miR-100
Sequence

12 - 

aacccguaaauccgaacuugug

 - 33

Get sequence
Deep sequencing12736 reads, 48 experiments
Evidence experimental; Northern [1,3], 454 [4-5], Illumina [5]
Database links
Predicted targets

Mature sequence dme-miR-100-3p

Accession MIMAT0020818
Sequence

51 - 

caagaccggcauuaugggaguc

 - 72

Get sequence
Deep sequencing1894 reads, 40 experiments
Evidence not experimental
Database links

References

1
2
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
3
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).