Stem-loop sequence dme-mir-285

AccessionMI0000377 (change log)
DescriptionDrosophila melanogaster miR-285 stem-loop
Gene family MIPF0000009; mir-29
Literature search

8 open access papers mention dme-mir-285
(13 sentences)

Stem-loop
   ---  ga       -a     ga    u      a    --uaucag   aa 
5'    uc  aucgaag  acuga  ucga uggugc uaga        gag  c
      ||  |||||||  |||||  |||| |||||| ||||        |||   
3'    ag  uaguuuu  ugacu  agcu accacg aucu        cuc  c
   caa  aa       cg     aa    u      -    caauuuaa   ac 
Get sequence
Deep sequencing
80473 reads, 2.05e+03 reads per million, 48 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-285 was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the ends of the excised miRNA by cloning.

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3L: 11946093-11946191 [-]
intergenic
Database links

Mature sequence dme-miR-285-5p

Accession MIMAT0020817
Sequence

13 - 

acugagaucgauuggugcauaga

 - 35

Get sequence
Deep sequencing19845 reads, 36 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-285-3p

Accession MIMAT0000356
Previous IDsdme-miR-285
Sequence

64 - 

uagcaccauucgaaaucagugc

 - 85

Get sequence
Deep sequencing60574 reads, 47 experiments
Evidence experimental; cloned [2], 454 [3], Illumina [4]
Database links
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).