Stem-loop sequence dme-mir-210

Accession MI0000376
Description Drosophila melanogaster miR-210 stem-loop
Gene family MIPF0000086; mir-210
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-210_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-210 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. mir-210 has been strongly linked with the hypoxia pathway, and is upregulated in response to Hypoxia-inducible factors. It is also overexpressed in cells affected by cardiac disease and tumours. MiRNA-210 in particular, has been studied for its effects in rescuing cardiac function after myocardial infarcts via the up-regulation of angiogenesis and inhibition of cardiomyocyte apoptosis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
------------aaa   -g     ugc        gc   -         uuaga 
               ggu  cuuau   agcugcug  cac ugcacaaga     c
               |||  |||||   ||||||||  ||| |||||||||     u
               ccg  gaaug   ucggcgac  gug gcguguucu     u
ccgacaacgaagaua   ga     uua        -a   u         cagaa 
Get sequence
Deep sequencing
163297 reads, 44 experiments
Comments

This sequence is computationally predicted based on conservation in D. pseudoobscura. The precise 5' or 3' ends are unknown. Northern blotting confirmed that the strand containing the predicted miR is predominantly expressed. The sequence is localised to chromosome X.

Genome context
Coordinates (BDGP5.0) Overlapping transcripts
X: 18022252-18022351 [+]
intergenic
Clustered miRNAs
< 10kb from dme-mir-210
dme-mir-969 X: 18018390-18018483 [+]
dme-mir-210 X: 18022252-18022351 [+]

Mature sequence dme-miR-210-5p

Accession MIMAT0020816
Sequence

16 - 

agcugcuggccacugcacaagau

 - 38

Get sequence
Deep sequencing 18886 reads, 32 experiments
Evidence not experimental
Predicted targets

Mature sequence dme-miR-210-3p

Accession MIMAT0000355
Previous IDs dme-miR-210
Sequence

53 - 

uugugcgugugacagcggcua

 - 73

Get sequence
Deep sequencing 144410 reads, 43 experiments
Evidence experimental; cloned [2], 454 [3-4], Solexa [4]
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).