Stem-loop sequence dme-mir-210

AccessionMI0000376 (change log)
DescriptionDrosophila melanogaster miR-210 stem-loop
Gene family MIPF0000086; mir-210
Literature search

8 open access papers mention dme-mir-210
(29 sentences)

Stem-loop
   ------------aaa   -g     ugc        gc   -         uuaga 
5'                ggu  cuuau   agcugcug  cac ugcacaaga     c
                  |||  |||||   ||||||||  ||| |||||||||     u
3'                ccg  gaaug   ucggcgac  gug gcguguucu     u
   ccgacaacgaagaua   ga     uua        -a   u         cagaa 
Get sequence
Deep sequencing
287197 reads, 2.54e+03 reads per million, 48 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is computationally predicted based on conservation in D. pseudoobscura. The precise 5' or 3' ends are unknown. Northern blotting confirmed that the strand containing the predicted miR is predominantly expressed.

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 18128219-18128318 [+]
intergenic
Clustered miRNAs
< 10kb from dme-mir-210
dme-mir-969chrX: 18124357-18124450 [+]
dme-mir-210chrX: 18128219-18128318 [+]
Database links

Mature sequence dme-miR-210-5p

Accession MIMAT0020816
Sequence

16 - 

agcugcuggccacugcacaagau

 - 38

Get sequence
Deep sequencing5397 reads, 43 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-210-3p

Accession MIMAT0000355
Previous IDsdme-miR-210
Sequence

52 - 

cuugugcgugugacagcggcuau

 - 74

Get sequence
Deep sequencing281799 reads, 47 experiments
Evidence experimental; cloned [2], 454 [3-4], Illumina [4]
Database links
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).