Stem-loop sequence dme-mir-276b

AccessionMI0000375 (change log)
DescriptionDrosophila melanogaster miR-276b stem-loop
Gene family MIPF0000124; mir-276
Literature search

12 open access papers mention dme-mir-276b
(33 sentences)

Stem-loop
   aaaac   -      uuua   uc    a     a           uuc  au 
5'      cga agucuu    cca  agcg gguau gaguuccuacg   cu  a
        ||| ||||||    |||  |||| ||||| |||||||||||   ||   
3'      gcu ucagga    ggu  ucgu ccaua uucaaggaugc   ga  u
   --cca   g      ----   uc    g     a           --u  cu 
Get sequence
Deep sequencing
5845860 reads, 5.93e+04 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3L: 10319785-10319883 [+]
intergenic
Database links

Mature sequence dme-miR-276b-5p

Accession MIMAT0020815
Sequence

23 - 

cagcgagguauagaguuccuacg

 - 45

Get sequence
Deep sequencing220380 reads, 49 experiments
Evidence experimental; Northern [1], 454 [3-4], Illumina [4]
Database links

Mature sequence dme-miR-276b-3p

Accession MIMAT0000354
Previous IDsdme-miR-276b
Sequence

62 - 

uaggaacuuaauaccgugcucu

 - 83

Get sequence
Deep sequencing5625476 reads, 49 experiments
Evidence experimental; Northern [1], cloned [2], 454 [3-4], Illumina [4]
Database links
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).