Stem-loop sequence dme-mir-79

AccessionMI0000374 (change log)
DescriptionDrosophila melanogaster miR-79 stem-loop
Gene family MIPF0000014; mir-9
Literature search

12 open access papers mention dme-mir-79
(22 sentences)

Stem-loop
   u  ag   -acuu    u        cgc       g     --   au 
5'  ga  cug     gcca ugcuuugg   uuuagcu uauga  uag  u
    ||  |||     |||| ||||||||   ||||||| |||||  |||  u
3'  cu  gac     cggu acgaaacc   agaucga auacu  auc  a
   a  -g   gucuu    u        auu       a     uc   aa 
Get sequence
Deep sequencing
280461 reads, 6.74e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-79 was reported independently by three groups using computational prediction [2], Northern blot analysis [1] and cloning [3]. References [1] and [2] confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [3] confirmed the ends of the excised miRNA by cloning.

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 16698554-16698650 [+]
sense
FBtr0100459 ; grp-RD; intron 4
FBtr0080884 ; grp-RB; intron 6
FBtr0080886 ; grp-RA; intron 6
FBtr0080885 ; grp-RC; intron 7
Clustered miRNAs
< 10kb from dme-mir-79
dme-mir-9cchr2L: 16697924-16698015 [+]
dme-mir-306chr2L: 16698404-16698488 [+]
dme-mir-79chr2L: 16698554-16698650 [+]
dme-mir-9bchr2L: 16698744-16698834 [+]
Database links

Mature sequence dme-miR-79-5p

Accession MIMAT0020814
Sequence

19 - 

gcuuuggcgcuuuagcuguauga

 - 41

Get sequence
Deep sequencing1343 reads, 47 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-79-3p

Accession MIMAT0000352
Previous IDsdme-miR-79
Sequence

60 - 

uaaagcuagauuaccaaagcau

 - 81

Get sequence
Deep sequencing279078 reads, 49 experiments
Evidence experimental; Northern [1], cloned [3], 454 [4-5], Illumina [5]
Database links
Predicted targets

References

1
2
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
3
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).