Stem-loop sequence dme-mir-34

AccessionMI0000371 (change log)
DescriptionDrosophila melanogaster miR-34 stem-loop
Gene family MIPF0000039; mir-34
Literature search

35 open access papers mention dme-mir-34
(371 sentences)

Stem-loop
   aauug   a  -   uu        u  u   c        --ua c    ua 
5'      gcu ug cgc  uggcagug gg uag ugguugug    g caau  u
        ||| || |||  |||||||| || ||| ||||||||    | ||||  u
3'      cga ac gcg  gccgucac uc auc accgacac    c guug  g
   -----   -  a   cc        u  u   -        uuaa a    cc 
Get sequence
Deep sequencing
3716255 reads, 3.77e+04 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is computationally predicted based on conservation in D. pseudoobscura and C. elegans. The precise 5' or 3' ends are unknown. Expression in D. melanogaster was confirmed by Northern blot analysis [1]. Aravin et al. later identify the 5' and 3' ends by cloning [3].

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 10100936-10101034 [+]
intergenic
Clustered miRNAs
< 10kb from dme-mir-34
dme-mir-317chr3R: 10091126-10091217 [+]
dme-mir-277chr3R: 10100022-10100121 [+]
dme-mir-34chr3R: 10100936-10101034 [+]
Database links

Mature sequence dme-miR-34-5p

Accession MIMAT0000350
Previous IDsdme-miR-34
Sequence

17 - 

uggcagugugguuagcugguugug

 - 40

Get sequence
Deep sequencing3543094 reads, 49 experiments
Evidence experimental; Northern [1], cloned [3], 454 [4-5], Illumina [5]
Database links
Predicted targets

Mature sequence dme-miR-34-3p

Accession MIMAT0020812
Sequence

68 - 

cagccacuaucuucacugccgcc

 - 90

Get sequence
Deep sequencing135429 reads, 49 experiments
Evidence not experimental
Database links

References

1
2
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
3
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).