Stem-loop sequence dme-mir-34

Accession MI0000371
Description Drosophila melanogaster miR-34 stem-loop
Gene family MIPF0000039; mir-34
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-34_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-34 microRNA precursor family are non-coding RNA molecules that, in mammals, give rise to three major mature miRNAs. The miR-34 family members were discovered computationally and later verified experimentally. The precursor miRNA stem-loop is processed in the cytoplasm of the cell, with the predominant miR-34 mature sequence excised from the 5' arm of the hairpin. The mature miR-34a is a part of the p53 tumor suppressor network of proteins; therefore, it is hypothesized that miR-34 dysregulation is involved in the development of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
aauug   a  -   uu        u  u   c        --ua c    ua 
     gcu ug cgc  uggcagug gg uag ugguugug    g caau  u
     ||| || |||  |||||||| || ||| ||||||||    | ||||  u
     cga ac gcg  gccgucac uc auc accgacac    c guug  g
-----   -  a   cc        u  u   -        uuaa a    cc 
Get sequence
Deep sequencing
1370015 reads, 50 experiments
Comments

This sequence is computationally predicted based on conservation in D. pseudoobscura and C. elegans. The precise 5' or 3' ends are unknown. Expression in D. melanogaster was confirmed by Northern blot analysis [1]. Aravin et al. later identify the 5' and 3' ends by cloning [3].

Genome context
Coordinates (BDGP5.0) Overlapping transcripts
3R: 5926658-5926756 [+]
sense
FBtr0082178 ; mir-34-RA; exon 1
Clustered miRNAs
< 10kb from dme-mir-34
dme-mir-317 3R: 5916848-5916939 [+]
dme-mir-277 3R: 5925744-5925843 [+]
dme-mir-34 3R: 5926658-5926756 [+]

Mature sequence dme-miR-34-5p

Accession MIMAT0000350
Previous IDs dme-miR-34
Sequence

17 - 

uggcagugugguuagcugguugug

 - 40

Get sequence
Deep sequencing 1202674 reads, 50 experiments
Evidence experimental; Northern [1], cloned [3], 454 [4-5], Solexa [5]
Predicted targets

Mature sequence dme-miR-34-3p

Accession MIMAT0020812
Sequence

68 - 

cagccacuaucuucacugccgcc

 - 90

Get sequence
Deep sequencing 161627 reads, 48 experiments
Evidence not experimental
Predicted targets

References

1
2
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
3
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).