|
miRBase |
|
Stem-loop sequence dme-mir-281-2 |
||||||
| Accession | MI0000370 | |||||
| Description | Drosophila melanogaster miR-281-2 stem-loop | |||||
| Gene family | MIPF0000087; mir-46 | |||||
| Community annotation |
This text is a summary paragraph taken from the Wikipedia entry entitled mir-46/mir-47/mir-281_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ... In molecular biology, mir-46 (MI0000017) and mir-47 (MI0000018) are microRNA expressed in C. elegans from related hairpin precursor sequences. The predicted hairpin precursor sequences for Drosophila mir-281 (MI0000366, MI0000370) are also related and, hence, belong to this family. The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequences are expressed from the 3' arms of the hairpin precursors. |
|||||
| Stem-loop |
u gaa ug -ua c ---ca aa cgaau gu a aagagagc uccgu gacagu aguu g ||||| || | |||||||| ||||| |||||| |||| gcuua ca u uucucucg aggua cuguca uuag a - aua gu uua - uaaug cc |
|||||
| Deep sequencing |
| |||||
| Comments |
miR-281 was reported independently in references [1] and [2]. The sequence in this entry is from reference [2] which identified a 23 nt excised sequence from the 3' arm of the precursor by cloning. Reference [1] reported the reverse complement of this foldback precursor from computational prediction and northern blotting. The predicted mature sequence (5' and 3' ends unknown) from the 3' arm of the reverse complement was named miR-281b in reference [1] and is designated miR-281-2* here. The predicted precursor maps to chromosome 2R. |
|||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
Mature sequence dme-miR-281-2-5p |
|
| Accession | MIMAT0000349 |
| Previous IDs | dme-miR-281-2* |
| Sequence |
15 - aagagagcuauccgucgacagu - 36 |
| Deep sequencing | 9300 reads, 50 experiments |
| Evidence | experimental; Northern [1], 454 [3-4], Solexa [4] |
| Predicted targets |
|
Mature sequence dme-miR-281-3p |
|
| Accession | MIMAT0000345 |
| Previous IDs | dme-miR-281 |
| Sequence |
60 - ugucauggaauugcucucuuugu - 82 |
| Deep sequencing | 59995 reads, 50 experiments |
| Evidence | experimental; Northern [1], cloned [2], 454 [3-4], Solexa [4] |
| Predicted targets |
|
References |
|
| 1 |
PMID:12844358
"Computational identification of Drosophila microRNA genes"
Genome Biol. 4:R42(2003).
|
| 2 |
PMID:12919683
"The small RNA profile during Drosophila melanogaster development"
Dev Cell. 5:337-350(2003).
|
| 3 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
| 4 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|