Stem-loop sequence dme-mir-281-2

Accession

MI0000370

Description

Drosophila melanogaster miR-281-2 stem-loop

Gene family

MIPF0000087; mir-46

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-46/mir-47/mir-281_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

In molecular biology, mir-46 (MI0000017) and mir-47 (MI0000018) are microRNA expressed in C. elegans from related hairpin precursor sequences. The predicted hairpin precursor sequences for Drosophila mir-281 (MI0000366, MI0000370) are also related and, hence, belong to this family. The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequences are expressed from the 3' arms of the hairpin precursors.

Stem-loop

     u  gaa ug        -ua     c      ---ca    aa 
cgaau gu   a  aagagagc   uccgu gacagu     aguu  g
||||| ||   |  ||||||||   ||||| ||||||     ||||   
gcuua ca   u  uucucucg   aggua cuguca     uuag  a
     -  aua gu        uua     -      uaaug    cc 

Deep sequencing

39316 reads, 50 experiments

Comments

miR-281 was reported independently in references [1] and [2]. The sequence in this entry is from reference [2] which identified a 23 nt excised sequence from the 3' arm of the precursor by cloning. Reference [1] reported the reverse complement of this foldback precursor from computational prediction and northern blotting. The predicted mature sequence (5' and 3' ends unknown) from the 3' arm of the reverse complement was named miR-281b in reference [1] and is designated miR-281-2* here. The predicted precursor maps to chromosome 2R.

Genome context

• Coordinates (BDGP5.0): 2R: 8057658-8057749 [-]
• Overlapping transcripts:

  sense

  FBtr0088013 ; Oda-RA; intron 1

  FBtr0088014 ; Oda-RC; intron 1

  FBtr0088013 ; Oda-RA; intron 1

  FBtr0088014 ; Oda-RC; intron 1

  FBtr0088013 ; Oda-RA; intron 1

  FBtr0088014 ; Oda-RC; intron 1

Clustered miRNAs

< 10kb from dme-mir-281-2

• dme-mir-281-1: 2R: 8057878-8057967 [-]
• dme-mir-281-2: 2R: 8057658-8057749 [-]

Mature sequence dme-miR-281-2-5p

• Accession: MIMAT0000349
• Previous IDs: dme-miR-281-2*
• Sequence: 15 - aagagagcuauccgucgacagu - 36
• Deep sequencing: 9300 reads, 50 experiments
• Evidence: experimental; Northern [1], 454 [3-4], Solexa [4]
• Predicted targets:
  • MICRORNA.ORG:dme-miR-281-2-5p
  • RNA22-DME:dme-miR-281-2-5p
  • MIRTE:miR-281bS
  • PICTAR-FLY:dme-miR-281
  • PICTAR-FLY:dme-miR-281-2*

Mature sequence dme-miR-281-3p

• Accession: MIMAT0000345
• Previous IDs: dme-miR-281
• Sequence: 60 - ugucauggaauugcucucuuugu - 82
• Deep sequencing: 59995 reads, 50 experiments
• Evidence: experimental; Northern [1], cloned [2], 454 [3-4], Solexa [4]
• Predicted targets:
  • MICRORNA.ORG:dme-miR-281-3p
  • RNA22-DME:dme-miR-281-3p
  • MIRTE:miR-281bS
  • PICTAR-FLY:dme-miR-281
  • PICTAR-FLY:dme-miR-281-2*

References

1. PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2. PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3. PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4. PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).