Stem-loop sequence dme-mir-281-2

AccessionMI0000370 (change log)
DescriptionDrosophila melanogaster miR-281-2 stem-loop
Gene family MIPF0000087; mir-46
Literature search

13 open access papers mention dme-mir-281-2
(27 sentences)

Stem-loop
        u  gaa ug        -ua     c      ---ca    aa 
5' cgaau gu   a  aagagagc   uccgu gacagu     aguu  g
   ||||| ||   |  ||||||||   ||||| ||||||     ||||   
3' gcuua ca   u  uucucucg   aggua cuguca     uuag  a
        -  aua gu        uua     -      uaaug    cc 
Get sequence
Deep sequencing
2370130 reads, 1.25e+04 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-281 was reported independently in references [1] and [2]. The sequence in this entry is from reference [2] which identified a 23 nt excised sequence from the 3' arm of the precursor by cloning. Reference [1] reported the reverse complement of this foldback precursor from computational prediction and northern blotting. The predicted mature sequence (5' and 3' ends unknown) from the 3' arm of the reverse complement was named miR-281b in reference [1] and is designated miR-281-2* here.

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 12170153-12170244 [-]
sense
FBtr0088013 ; Oda-RA; intron 1
FBtr0088014 ; Oda-RC; intron 1
Clustered miRNAs
< 10kb from dme-mir-281-2
dme-mir-281-1chr2R: 12170373-12170462 [-]
dme-mir-281-2chr2R: 12170153-12170244 [-]
Database links

Mature sequence dme-miR-281-2-5p

Accession MIMAT0000349
Previous IDsdme-miR-281-2*
Sequence

15 - 

aagagagcuauccgucgacagu

 - 36

Get sequence
Deep sequencing2167282 reads, 49 experiments
Evidence experimental; Northern [1], 454 [3-4], Illumina [4]
Database links
Predicted targets

Mature sequence dme-miR-281-3p

Accession MIMAT0000345
Previous IDsdme-miR-281
Sequence

60 - 

ugucauggaauugcucucuuugu

 - 82

Get sequence
Deep sequencing405024 reads, 49 experiments
Evidence experimental; Northern [1], cloned [2], 454 [3-4], Illumina [4]
Database links
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).