|
miRBase |
|
Stem-loop sequence dme-mir-284 |
|||||
| Accession | MI0000369 | ||||
| Description | Drosophila melanogaster miR-284 stem-loop | ||||
| Gene family | MIPF0000228; mir-284 | ||||
| Stem-loop |
---- c a uguagccugugagggcaag guugcaguu cuggaauuaaguug cug g ||||||||| |||||||||||||| ||| c cggcguuaa gaccuuaguucaac gac u agcc c - ugaaguccucguaauaagu |
||||
| Deep sequencing |
| ||||
| Comments |
This sequence is computationally predicted based on conservation in D. pseudoobscura. The precise 5' or 3' ends are unknown. Northern blotting confirmed that the strand containing the predicted miR is predominantly expressed. The sequence is localised to chromosome 3R. |
||||
| Genome context |
|
||||
Mature sequence dme-miR-284-5p |
|
| Accession | MIMAT0020811 |
| Sequence |
10 - ccuggaauuaaguugacuguguagcc - 35 |
| Deep sequencing | 7951 reads, 40 experiments |
| Evidence | not experimental |
| Predicted targets |
|
Mature sequence dme-miR-284-3p |
|
| Accession | MIMAT0000348 |
| Previous IDs | dme-miR-284 |
| Sequence |
64 - ugaagucagcaacuugauuccagcaauug - 92 |
| Deep sequencing | 37836 reads, 45 experiments |
| Evidence | experimental; Northern [1], 454 [2-3], Solexa [3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:12844358
"Computational identification of Drosophila microRNA genes"
Genome Biol. 4:R42(2003).
|
| 2 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
| 3 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|