Stem-loop sequence dme-mir-284

AccessionMI0000369 (change log)
DescriptionDrosophila melanogaster miR-284 stem-loop
Gene family MIPF0000228; mir-284
Literature search

1 open access papers mention dme-mir-284
(1 sentences)

Stem-loop
   ----         c              a   uguagccugugagggcaag 
5'     guugcaguu cuggaauuaaguug cug                   g
       ||||||||| |||||||||||||| |||                   c
3'     cggcguuaa gaccuuaguucaac gac                   u
   agcc         c              -   ugaaguccucguaauaagu 
Get sequence
Deep sequencing
228518 reads, 1.7e+03 reads per million, 46 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 12551515-12551614 [-]
intergenic
Database links

Mature sequence dme-miR-284-5p

Accession MIMAT0020811
Sequence

10 - 

ccuggaauuaaguugacuguguagcc

 - 35

Get sequence
Deep sequencing199876 reads, 42 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-284-3p

Accession MIMAT0000348
Previous IDsdme-miR-284
Sequence

68 - 

gucagcaacuugauuccagca

 - 88

Get sequence
Deep sequencing28606 reads, 46 experiments
Evidence experimental; Northern [1], 454 [2-3], Illumina [3]
Database links
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
3
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).