Stem-loop sequence dme-mir-283

Accession MI0000368
Description Drosophila melanogaster miR-283 stem-loop
Gene family MIPF0000054; mir-216
Stem-loop 
cucacac     uc      aa           u         agcuaagccu 
       gauuc  aaaggu  auaucagcugg aauucuggg          a
       |||||  ||||||  ||||||||||| |||||||||           
       uuaag  uuuuca  uaugguugacu uuaaggcuc          a
-------     uu      gc           -         acaaaguaua
Get sequence
Deep sequencing
20465 reads, 50 experiments
Genome context
Coordinates (BDGP5.0) Overlapping transcripts
X: 15401989-15402088 [+]
sense
FBtr0074043 ; Gmap-RB; intron 4
FBtr0074043 ; Gmap-RB; intron 4
FBtr0074043 ; Gmap-RB; intron 4
FBtr0074042 ; Gmap-RA; intron 5
FBtr0074042 ; Gmap-RA; intron 5
FBtr0074042 ; Gmap-RA; intron 5
Clustered miRNAs
< 10kb from dme-mir-283
dme-mir-283 X: 15401989-15402088 [+]
dme-mir-304 X: 15402992-15403079 [+]
dme-mir-12 X: 15403506-15403579 [+]

Mature sequence dme-miR-283-5p

Accession MIMAT0000347
Previous IDs dme-miR-283
Sequence

21 -  

aaauaucagcugguaauucugg

 - 42

Get sequence
Deep sequencing 18415 reads, 50 experiments
Evidence experimental; Northern [1-2], 454 [3-4], Solexa [4]
Predicted targets

Mature sequence dme-miR-283-3p

Accession MIMAT0020810
Sequence

68 -  

cggaauuucaguugguaucga

 - 88

Get sequence
Deep sequencing 1520 reads, 45 experiments
Evidence not experimental
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).