Stem-loop sequence dme-mir-283

AccessionMI0000368 (change log)
DescriptionDrosophila melanogaster miR-283 stem-loop
Gene family MIPF0000054; mir-216
Literature search

9 open access papers mention dme-mir-283
(17 sentences)

Stem-loop
   cucacac     uc      aa           u         agcuaagccu 
5'        gauuc  aaaggu  auaucagcugg aauucuggg          a
          |||||  ||||||  ||||||||||| |||||||||           
3'        uuaag  uuuuca  uaugguugacu uuaaggcuc          a
   -------     uu      gc           -         acaaaguaua 
Get sequence
Deep sequencing
427629 reads, 1.93e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 15507956-15508055 [+]
sense
FBtr0074043 ; Gmap-RB; intron 4
FBtr0074042 ; Gmap-RA; intron 5
Clustered miRNAs
< 10kb from dme-mir-283
dme-mir-283chrX: 15507956-15508055 [+]
dme-mir-304chrX: 15508959-15509046 [+]
dme-mir-12chrX: 15509473-15509546 [+]
Database links

Mature sequence dme-miR-283-5p

Accession MIMAT0000347
Previous IDsdme-miR-283
Sequence

21 - 

aaauaucagcugguaauucugg

 - 42

Get sequence
Deep sequencing424478 reads, 49 experiments
Evidence experimental; Northern [1-2], 454 [3-4], Illumina [4]
Database links
Predicted targets

Mature sequence dme-miR-283-3p

Accession MIMAT0020810
Sequence

68 - 

cggaauuucaguugguaucga

 - 88

Get sequence
Deep sequencing2794 reads, 49 experiments
Evidence not experimental
Database links

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).