|
miRBase |
|
Stem-loop sequence dme-mir-280 |
|||||
| Accession | MI0000365 | ||||
| Description | Drosophila melanogaster miR-280 stem-loop | ||||
| Gene family | MIPF0000240; mir-280 | ||||
| Stem-loop |
---------u --ua u g --a ggcuuu uguau uac uugcauaugaaaugau uuuau |||||| ||||| ||| |||||||||||||||| |||| a cuggag acgua aug gacguauauuuuauua aaaug gucacaccuc cuga u - gac |
||||
| Deep sequencing |
| ||||
| Comments |
This sequence is computationally predicted based on conservation in D. pseudoobscura. The precise 5' or 3' ends are unknown. Northern blotting confirmed that the strand containing the predicted miR is predominantly expressed. The sequence is localised to chromosome 2R. |
||||
| Genome context |
|
||||
Mature sequence dme-miR-280-5p |
|
| Accession | MIMAT0000343 |
| Previous IDs | dme-miR-280 |
| Sequence |
10 - uguauuuacguugcauaugaaaugaua - 36 |
| Deep sequencing | 3 reads, 3 experiments |
| Evidence | experimental; Northern [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:12844358
"Computational identification of Drosophila microRNA genes"
Genome Biol. 4:R42(2003).
|