Stem-loop sequence dme-mir-33

AccessionMI0000364 (change log)
DescriptionDrosophila melanogaster miR-33 stem-loop
Gene family MIPF0000070; mir-33
Literature search

12 open access papers mention dme-mir-33
(25 sentences)

Stem-loop
   cucuuccucug      a    a  -g       u   c c        ucc a 
5'            gagaug cacg ag  ugcauug agu g auugucug   c a
              |||||| |||| ||  ||||||| ||| | ||||||||   |  
3'            cuuuac gugu uc  acgugac uca c uaacggac   g u
   ---------ca      -    c  ga       u   a a        uuc u 
Get sequence
Deep sequencing
572146 reads, 4.97e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3L: 19797961-19798059 [+]
sense
FBtr0074875 ; HLH106-RC; intron 5
FBtr0074873 ; HLH106-RA; intron 6
FBtr0074874 ; HLH106-RB; intron 6
FBtr0333877 ; HLH106-RD; intron 6
Database links

Mature sequence dme-miR-33-5p

Accession MIMAT0000342
Previous IDsdme-miR-33
Sequence

26 - 

gugcauuguagucgcauuguc

 - 46

Get sequence
Deep sequencing564075 reads, 49 experiments
Evidence experimental; 454 [2-3], Illumina [3]
Database links
Predicted targets

Mature sequence dme-miR-33-3p

Accession MIMAT0020808
Sequence

65 - 

caauacaacuucagugcaagcu

 - 86

Get sequence
Deep sequencing7580 reads, 49 experiments
Evidence not experimental
Database links

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
3
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).