Stem-loop sequence dme-mir-133

AccessionMI0000362 (change log)
DescriptionDrosophila melanogaster miR-133 stem-loop
Gene family MIPF0000029; mir-133
Literature search

17 open access papers mention dme-mir-133
(59 sentences)

Stem-loop
   ---accug    -    ug             cauc  gu     -  guu 
5'         caac acug  uguagcugguuga    gg  cagau cu   u
           |||| ||||  |||||||||||||    ||  ||||| ||    
3'         guug ugac  augucgaccaacu    cc  guuua ga   u
   caacagua    g    cg             -ucc  ug     c  acu 
Get sequence
Deep sequencing
94819 reads, 1.3e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-133 was reported independently by three groups using computational prediction [2], Northern blot analysis [1] and cloning [3]. References [1] and [2] confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [3] confirmed the ends of the excised miRNA by cloning.

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 20616617-20616714 [+]
intergenic
Clustered miRNAs
< 10kb from dme-mir-133
dme-mir-133chr2L: 20616617-20616714 [+]
dme-mir-288chr2L: 20618366-20618462 [-]
Database links

Mature sequence dme-miR-133-5p

Accession MIMAT0020806
Sequence

19 - 

agcugguugacaucgggucagau

 - 41

Get sequence
Deep sequencing1375 reads, 42 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-133-3p

Accession MIMAT0000340
Previous IDsdme-miR-133
Sequence

57 - 

uugguccccuucaaccagcugu

 - 78

Get sequence
Deep sequencing93440 reads, 49 experiments
Evidence experimental; Northern [1,3], 454 [4-5], Illumina [5]
Database links
Predicted targets

References

1
2
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
3
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).