Stem-loop sequence dme-mir-278

AccessionMI0000361 (change log)
DescriptionDrosophila melanogaster miR-278 stem-loop
Gene family MIPF0000155; mir-278
Literature search

6 open access papers mention dme-mir-278
(13 sentences)

Stem-loop
   -------gu      acgg     c       u     a  a     g   ca 
5'          aauggu    ugcga cggauga gguuc ca cgacc ugu  u
            ||||||    ||||| ||||||| ||||| || ||||| |||  u
3'          uuaccg    auguu gccugcu ucagg gu gcugg gca  u
   agcaacugu      --ca     u       u     -  g     -   aa 
Get sequence
Deep sequencing
135269 reads, 3.21e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-278 was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the 5' end of the excised miRNA by cloning and reported a length distribution of 20-22 nt with 22 nt the most commonly expressed.

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 15657066-15657163 [+]
intergenic
Database links

Mature sequence dme-miR-278-5p

Accession MIMAT0020805
Sequence

18 - 

ccggaugaugguucacaacgacc

 - 40

Get sequence
Deep sequencing22580 reads, 47 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-278-3p

Accession MIMAT0000339
Previous IDsdme-miR-278
Sequence

57 - 

ucggugggacuuucguccguuu

 - 78

Get sequence
Deep sequencing112667 reads, 49 experiments
Evidence experimental; Northern [1-2], cloned [2], 454 [3-4], Illumina [4]
Database links
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).