Stem-loop sequence dme-mir-277

Accession

MI0000360 (change log)

Description

Drosophila melanogaster miR-277 stem-loop

Gene family

MIPF0000156; mir-277

Literature search

24 open access papers mention dme-mir-277
(222 sentences)

Stem-loop

   ----   a g       gc  -   gu    -            c  aaa u 
5'     uug a guuuugg  ug cgu  cagg agugcauuugca ug   c a
       ||| | |||||||  || |||  |||| |||||||||||| ||   | u
3'     aac u caagacc  ac gca  gucu ucacguaaaugu ac   g c
   uucu   a g       uu  a   ug    a            -  gaa u 

Deep sequencing

3383390 reads, 2.42e+04 reads per million, 49 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-277 was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the 5' end of the excised miRNA by cloning and reported a length distribution of 21-23 nt with 23 nt the most commonly expressed. Stark et al. [3] have predicted that miR-277 controls the pathway for valine, leucine and isoleucine degradation by downregulating many of its enzymes.

Genome context

• Coordinates (Release_6; GCA_000001215.4): chr3R: 10100022-10100121 [+]
• Overlapping transcripts:

  sense

  FBtr0309197 ; CR43459-RB; exon 1

Clustered miRNAs

< 10kb from dme-mir-277

• dme-mir-317: chr3R: 10091126-10091217 [+]
• dme-mir-277: chr3R: 10100022-10100121 [+]
• dme-mir-34: chr3R: 10100936-10101034 [+]

Database links

• RNAcentral:URS00002DB52A_7227
• miRBase Tracker:MI0000360

Mature sequence dme-miR-277-5p

• Accession: MIMAT0020804
• Sequence: 18 - cgugucaggagugcauuugca - 38
• Deep sequencing: 17951 reads, 49 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS000009A7D7_7227

Mature sequence dme-miR-277-3p

• Accession: MIMAT0000338
• Previous IDs: dme-miR-277
• Sequence: 59 - uaaaugcacuaucugguacgaca - 81
• Deep sequencing: 3364617 reads, 49 experiments
• Evidence: experimental; Northern [1], cloned [2], 454 [4-5], Illumina [5]
• Database links:
  • RNAcentral:URS00001B9842_7227
• Predicted targets:
  • TargetScanFly:dme-miR-277
  • microrna.org:dme-miR-277-3p

References

1. PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2. PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3. PMID:14691535 "Identification of Drosophila MicroRNA targets" Stark A, Brennecke J, Russell RB, Cohen SM PLoS Biol. 1:E60(2003).
4. PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5. PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).