Stem-loop sequence dme-mir-277

AccessionMI0000360 (change log)
DescriptionDrosophila melanogaster miR-277 stem-loop
Gene family MIPF0000156; mir-277
Literature search

24 open access papers mention dme-mir-277
(222 sentences)

Stem-loop
   ----   a g       gc  -   gu    -            c  aaa u 
5'     uug a guuuugg  ug cgu  cagg agugcauuugca ug   c a
       ||| | |||||||  || |||  |||| |||||||||||| ||   | u
3'     aac u caagacc  ac gca  gucu ucacguaaaugu ac   g c
   uucu   a g       uu  a   ug    a            -  gaa u 
Get sequence
Deep sequencing
3383390 reads, 2.42e+04 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-277 was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the 5' end of the excised miRNA by cloning and reported a length distribution of 21-23 nt with 23 nt the most commonly expressed. Stark et al. [3] have predicted that miR-277 controls the pathway for valine, leucine and isoleucine degradation by downregulating many of its enzymes.

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 10100022-10100121 [+]
sense
FBtr0309197 ; CR43459-RB; exon 1
Clustered miRNAs
< 10kb from dme-mir-277
dme-mir-317chr3R: 10091126-10091217 [+]
dme-mir-277chr3R: 10100022-10100121 [+]
dme-mir-34chr3R: 10100936-10101034 [+]
Database links

Mature sequence dme-miR-277-5p

Accession MIMAT0020804
Sequence

18 - 

cgugucaggagugcauuugca

 - 38

Get sequence
Deep sequencing17951 reads, 49 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-277-3p

Accession MIMAT0000338
Previous IDsdme-miR-277
Sequence

59 - 

uaaaugcacuaucugguacgaca

 - 81

Get sequence
Deep sequencing3364617 reads, 49 experiments
Evidence experimental; Northern [1], cloned [2], 454 [4-5], Illumina [5]
Database links
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3
PMID:14691535 "Identification of Drosophila MicroRNA targets" Stark A, Brennecke J, Russell RB, Cohen SM PLoS Biol. 1:E60(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).