![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence dme-mir-277 |
||||||||
Accession | MI0000360 (change log) | |||||||
Description | Drosophila melanogaster miR-277 stem-loop | |||||||
Gene family | MIPF0000156; mir-277 | |||||||
Literature search |
![]()
24 open access papers mention dme-mir-277 | |||||||
Stem-loop |
---- a g gc - gu - c aaa u 5' uug a guuuugg ug cgu cagg agugcauuugca ug c a ||| | ||||||| || ||| |||| |||||||||||| || | u 3' aac u caagacc ac gca gucu ucacguaaaugu ac g c uucu a g uu a ug a - gaa u |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Comments |
miR-277 was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the 5' end of the excised miRNA by cloning and reported a length distribution of 21-23 nt with 23 nt the most commonly expressed. Stark et al. [3] have predicted that miR-277 controls the pathway for valine, leucine and isoleucine degradation by downregulating many of its enzymes. |
|||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence dme-miR-277-5p |
|
Accession | MIMAT0020804 |
Sequence |
18 - cgugucaggagugcauuugca - 38 |
Deep sequencing | 17951 reads, 49 experiments |
Evidence | not experimental |
Database links |
|
Mature sequence dme-miR-277-3p |
|
Accession | MIMAT0000338 |
Previous IDs | dme-miR-277 |
Sequence |
59 - uaaaugcacuaucugguacgaca - 81 |
Deep sequencing | 3364617 reads, 49 experiments |
Evidence | experimental; Northern [1], cloned [2], 454 [4-5], Illumina [5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12844358
"Computational identification of Drosophila microRNA genes"
Genome Biol. 4:R42(2003).
|
2 |
PMID:12919683
"The small RNA profile during Drosophila melanogaster development"
Dev Cell. 5:337-350(2003).
|
3 |
PMID:14691535
"Identification of Drosophila MicroRNA targets"
PLoS Biol. 1:E60(2003).
|
4 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
5 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|