Stem-loop sequence dme-mir-276a

AccessionMI0000359 (change log)
DescriptionDrosophila melanogaster miR-276a stem-loop
Gene family MIPF0000124; mir-276
Literature search

15 open access papers mention dme-mir-276a
(41 sentences)

Stem-loop
   -----------cc      uug   uc    a     ag          uucau 
5'              ugguuu   cca  agcg gguau  aguuccuacg     u
                ||||||   |||  |||| |||||  ||||||||||     a
3'              accaga   ggu  ucgu ccaua  ucaaggaugc     u
   gaaccaacaaaaa      --a   uc    g     cu          ucaaa 
Get sequence
Deep sequencing
6204208 reads, 6.31e+04 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-276 was reported independently in references [1] and [2]. Reference [2] reported a 22 nt excised sequence from the 3' arm of the precursor by cloning. Computational approaches followed by Northern blotting predicted an excised sequence from the 5' arm which is designated miR-276a* here [1].

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3L: 10365228-10365325 [+]
intergenic
Database links

Mature sequence dme-miR-276a-5p

Accession MIMAT0000336
Previous IDsdme-miR-276a*;dme-miR-276*
Sequence

16 - 

cagcgagguauagaguuccuacg

 - 38

Get sequence
Deep sequencing220371 reads, 49 experiments
Evidence experimental; Northern [1], 454 [3-4], Illumina [4]
Database links
Predicted targets

Mature sequence dme-miR-276a-3p

Accession MIMAT0000337
Previous IDsdme-miR-276a
Sequence

54 - 

uaggaacuucauaccgugcucu

 - 75

Get sequence
Deep sequencing5983835 reads, 49 experiments
Evidence experimental; Northern [1], cloned [2], 454 [3-4], Illumina [4]
Database links
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).