Stem-loop sequence dme-mir-219

AccessionMI0000358 (change log)
DescriptionDrosophila melanogaster miR-219 stem-loop
Gene family MIPF0000044; mir-219
Literature search

6 open access papers mention dme-mir-219
(7 sentences)

Stem-loop
   ---ua    -g     u   ua    u     aa           ----   a 
5'      auuc  auuuu agc  ugau gucca  cgcaauucuug    uug u
        ||||  ||||| |||  |||| |||||  |||||||||||    ||| a
3'      uaag  uaaag ucg  gcua cgggu  gcguugggaac    aac u
   caaca    aa     c   gc    -     ca           uuau   u 
Get sequence
Deep sequencing
5931 reads, 154 reads per million, 46 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is computationally predicted based on conservation in D. pseudoobscura [1]. The sequence of the excised miR is strikingly conserved in human (MI0000296), but the expression of the miR has not been confirmed in fly and the precise 5' or 3' ends are unknown.

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3L: 17315006-17315105 [+]
intergenic
Database links

Mature sequence dme-miR-219-5p

Accession MIMAT0000335
Previous IDsdme-miR-219
Sequence

19 - 

ugauuguccaaacgcaauucu

 - 39

Get sequence
Deep sequencing5816 reads, 46 experiments
Evidence experimental; 454 [2-3], Illumina [3]
Database links
Predicted targets

Mature sequence dme-miR-219-3p

Accession MIMAT0020803
Sequence

59 - 

aggguugcgacugggcaucgcg

 - 80

Get sequence
Deep sequencing114 reads, 33 experiments
Evidence not experimental
Database links

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
3
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).