Stem-loop sequence dme-mir-92a

AccessionMI0000357 (change log)
DescriptionDrosophila melanogaster miR-92a stem-loop
Gene family MIPF0000013; mir-25
Literature search

25 open access papers mention dme-mir-92a
(376 sentences)

Stem-loop
   -----aa  ug   uu        a     -     u   c    -ug a 
5'        ua  aau  cccguagg cggga aggug caa guuu   c u
          ||  |||  |||||||| ||||| ||||| ||| ||||   | u
3'        au  uug  ggguaucc gcccu uucac guu caaa   g u
   acaaaua  gu   gc        g     g     -   a    uaa c 
Get sequence
Deep sequencing
184486 reads, 6.13e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-92a was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the 5' end of the excised miRNA by cloning and reported a length distribution of 22-25 nt with 22 nt the most commonly expressed.

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 25646506-25646600 [+]
sense
FBtr0084886 ; jigr1-RA; intron 1
FBtr0084887 ; jigr1-RB; intron 1
FBtr0084888 ; jigr1-RD; intron 1
FBtr0113287 ; jigr1-RE; intron 1
FBtr0084889 ; jigr1-RC; intron 1
Clustered miRNAs
< 10kb from dme-mir-92a
dme-mir-92achr3R: 25646506-25646600 [+]
dme-mir-92bchr3R: 25651398-25651497 [+]
Database links

Mature sequence dme-miR-92a-5p

Accession MIMAT0020802
Sequence

17 - 

aggacgggaaggugucaacguu

 - 38

Get sequence
Deep sequencing18344 reads, 49 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-92a-3p

Accession MIMAT0000334
Previous IDsdme-miR-92a
Sequence

55 - 

cauugcacuugucccggccuau

 - 76

Get sequence
Deep sequencing166066 reads, 49 experiments
Evidence experimental; cloned [2], Northern [3], 454 [4-5], Illumina [5]
Database links
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).