Stem-loop sequence dme-mir-275

AccessionMI0000356 (change log)
DescriptionDrosophila melanogaster miR-275 stem-loop
Gene family MIPF0000187; mir-275
Literature search

11 open access papers mention dme-mir-275
(19 sentences)

Stem-loop
   uguaaa    c     u         -a    ug   gg     guuuu 
5'       gucu cuacc ugcgcgcua  ucag  acc  ggcug     u
         |||| ||||| |||||||||  ||||  |||  |||||      
3'       caga ggugg gcgcgcgau  aguc  ugg  cugac     u
   uauaua    c     u         ga    ca   -a     auaua 
Get sequence
Deep sequencing
208089 reads, 2.64e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-275 was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the 5' end of the excised miRNA by cloning and reported a length distribution of 19-25 nt with 22 nt the most commonly expressed.

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 7425795-7425892 [+]
sense
FBtr0332524 ; CR43857-RA; exon 2
FBtr0332525 ; CR43857-RB; exon 2
Clustered miRNAs
< 10kb from dme-mir-275
dme-mir-275chr2L: 7425795-7425892 [+]
dme-mir-305chr2L: 7425972-7426044 [+]
Database links

Mature sequence dme-miR-275-5p

Accession MIMAT0020801
Sequence

20 - 

cgcgcuaaucagugaccggggcu

 - 42

Get sequence
Deep sequencing14821 reads, 49 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-275-3p

Accession MIMAT0000333
Previous IDsdme-miR-275
Sequence

59 - 

ucagguaccugaaguagcgcgcg

 - 81

Get sequence
Deep sequencing193261 reads, 49 experiments
Evidence experimental; Northern [1], cloned [2], 454 [3-4], Illumina [4]
Database links
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).