Stem-loop sequence dme-mir-184

AccessionMI0000354 (change log)
DescriptionDrosophila melanogaster miR-184 stem-loop
Gene family MIPF0000059; mir-184
Literature search

28 open access papers mention dme-mir-184
(58 sentences)

Stem-loop
   gguuggcc    c  u  ua         -     u  -  ccg   gcac 
5'         ggug au cg  cccuuauca uucuc cg cc   ugu    u
           |||| || ||  ||||||||| ||||| || ||   |||     
3'         ccac ua gc  gggaauagu aagag gc gg   aca    u
   cuacuuaa    -  u  uc         c     -  a  uca   gaaa 
Get sequence
Deep sequencing
24314847 reads, 1.37e+05 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-184 was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the 5' end of the excised miRNA by cloning and reported a length distribution of 19-23 nt with 22 nt the most commonly expressed. They also reported the less predominantly expressed sequence miR-184* from the opposite 5' arm.

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 13329402-13329501 [-]
intergenic
Database links

Mature sequence dme-miR-184-5p

Accession MIMAT0000330
Previous IDsdme-miR-184*
Sequence

22 - 

ccuuaucauucucucgccccg

 - 42

Get sequence
Deep sequencing5296 reads, 48 experiments
Evidence experimental; cloned [2], 454 [3-4], Illumina [4]
Database links
Predicted targets

Mature sequence dme-miR-184-3p

Accession MIMAT0000331
Previous IDsdme-miR-184
Sequence

61 - 

uggacggagaacugauaagggc

 - 82

Get sequence
Deep sequencing24309499 reads, 49 experiments
Evidence experimental; Northern [1], cloned [2], 454 [3-4], Illumina [4]
Database links
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).