Stem-loop sequence dme-mir-184

Accession MI0000354
Description Drosophila melanogaster miR-184 stem-loop
Gene family MIPF0000059; mir-184
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-184. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-184 microRNA is a short non-coding RNA molecule. MicroRNAs (miRNAs) function as posttranscriptional regulators of expression levels of other genes by several mechanisms. Several targets for miR-184 have been described, including that of mediators of neurological development, apoptosis and it has been suggested that miR-184 plays an essential role in development. MicroRNAs can bind to the three prime untranslated region (3’UTR) of the target messenger RNA (mRNA). Binding of the miRNA can hinder translation of mRNA by promoting degradation or inducing deadenylation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
gguuggcc    c  u  ua         -     u  -  ccg   gcac 
        ggug au cg  cccuuauca uucuc cg cc   ugu    u
        |||| || ||  ||||||||| ||||| || ||   |||     
        ccac ua gc  gggaauagu aagag gc gg   aca    u
cuacuuaa    -  u  uc         c     -  a  uca   gaaa 
Get sequence
Deep sequencing
reads, experiments
Comments

miR-184 was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the 5' end of the excised miRNA by cloning and reported a length distribution of 19-23 nt with 22 nt the most commonly expressed. They also reported the less predominantly expressed sequence miR-184* from the opposite 5' arm. The sequence is localised to chromosome 2R.

Genome context
Coordinates (BDGP5.0) Overlapping transcripts
2R: 9216907-9217006 [-]
intergenic

Mature sequence dme-miR-184-5p

Accession MIMAT0000330
Previous IDs dme-miR-184*
Sequence

22 - 

ccuuaucauucucucgccccg

 - 42

Get sequence
Evidence experimental; cloned [2], 454 [3-4], Solexa [4]
Predicted targets

Mature sequence dme-miR-184-3p

Accession MIMAT0000331
Previous IDs dme-miR-184
Sequence

61 - 

uggacggagaacugauaagggc

 - 82

Get sequence
Evidence experimental; Northern [1], cloned [2], 454 [3-4], Solexa [4]
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).