Stem-loop sequence cel-mir-272

AccessionMI0000352 (change log)
DescriptionCaenorhabditis elegans miR-272 stem-loop
Literature search

1 open access papers mention cel-mir-272
(2 sentences)

Stem-loop
   cgcaggcacgugcagguauguaggcaggcguaggcccguaggcaagu        -g       ga   u 
5'                                                guaggucu  caggcau  aug a
                                                  ||||||||  |||||||  |||  
3'                                                cguccaga  guuugug  uac g
   ----------------------------------------------g        ag       gg   g 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was predicted by computational approaches and validated using a PCR amplification protocol.

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 11637966-11638060 [-]
intergenic
Database links

Mature sequence cel-miR-272

Accession MIMAT0000328
Sequence

67 - 

uguaggcauggguguuug

 - 84

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; PCR [1], Illumina [2]
Predicted targets

References

1
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).
2