Stem-loop sequence cel-mir-271

AccessionMI0000351 (change log)
DescriptionCaenorhabditis elegans miR-271 stem-loop
Stem-loop
   aauagaaaac    cc     gc    c gg          -  gac 
5'           gggg  cgccg  ucgc g  uggaaagcau uc   a
             ||||  |||||  |||| |  |||||||||| ||    
3'           cccu  gcggc  agcg c  acuuuuugug ag   g
   -ucacuacua    ua     uc    u ua          c  aac 
Get sequence
Deep sequencing
54 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was predicted by computational approaches and validated using a PCR amplification protocol.

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 3412004-3412097 [+]
antisense
C04F6.8 ; C04F6.8; exon 1
Database links

Mature sequence cel-miR-271

Accession MIMAT0000327
Sequence

24 - 

ucgccggguggaaagcauuc

 - 43

Get sequence
Deep sequencing53 reads, 10 experiments
Evidence experimental; PCR [1]
Predicted targets

References

1
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).