Stem-loop sequence cel-mir-270

AccessionMI0000350 (change log)
DescriptionCaenorhabditis elegans miR-270 stem-loop
Stem-loop
   guc  u  -  -       c   c    -  --    uc       gugg 
5'    gc ag cc ucuuuac ugc uaca ca  ccuu  ugccuac    c
      || || || ||||||| ||| |||| ||  ||||  |||||||    a
3'    cg uc gg agaggug acg augu gu  ggga  acggaug    c
   cac  -  a  u       -   -    a  ac    ga       guua 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was predicted by computational approaches and validated using a PCR amplification protocol.

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 3258455-3258549 [-]
intergenic
Database links

Mature sequence cel-miR-270

Accession MIMAT0000326
Sequence

64 - 

ggcaugauguagcaguggag

 - 83

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; PCR [1]
Predicted targets

References

1
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).