Stem-loop sequence cel-mir-269

AccessionMI0000349 (change log)
DescriptionCaenorhabditis elegans miR-269 stem-loop
Gene family MIPF0000281; mir-266
Literature search

1 open access papers mention cel-mir-269
(7 sentences)

Stem-loop
              g       cuc   -ca        a  uau   gc 
5' gggcaaaaguu ggcaaga   ugg   aaacuugg uu   gcu  g
   ||||||||||| |||||||   |||   |||||||| ||   |||  c
3' ccuguuuuuaa cuguucu   acc   uuugaacc aa   uga  c
              a       -ca   cag        c  -uu   aa 
Get sequence
Deep sequencing
38 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This precursor sequence was predicted by comparative computational approaches. The excised miRNA sequence is predicted and the precise 5' or 3' end unknown. A PCR amplification protocol confirmed that the strand containing the predicted miR is predominantly expressed.

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 273900-273993 [+]
intergenic
Database links

Mature sequence cel-miR-269

Accession MIMAT0000325
Sequence

13 - 

ggcaagacucuggcaaaacu

 - 32

Get sequence
Deep sequencing16 reads, 7 experiments
Evidence experimental; PCR [1]
Predicted targets

References

1
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).