Stem-loop sequence cel-mir-268

AccessionMI0000348 (change log)
DescriptionCaenorhabditis elegans miR-268 stem-loop
Gene family MIPF0000280; mir-268
Literature search

1 open access papers mention cel-mir-268
(1 sentences)

Stem-loop
   g    ug cuuu       c      u         uu    -uc  a 
5'  gaag  g    gaagcgg aagaau agaagcagu  ggug   ag c
    ||||  |    ||||||| |||||| |||||||||  ||||   || a
3'  uuuc  u    uuucguc uuuuug ucuucguca  ucac   uc c
   u    gu --uc       u      u         -c    uca  a 
Get sequence
Deep sequencing
6 reads, 775 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This precursor sequence was predicted by comparative computational approaches. The excised miRNA sequence is predicted and the precise 5' or 3' end unknown. A PCR amplification protocol confirmed that the strand containing the predicted miR is predominantly expressed.

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrV: 11137110-11137204 [+]
sense
C06H2.5b ; C06H2.5b; intron 1
Database links

Mature sequence cel-miR-268

Accession MIMAT0000324
Sequence

18 - 

ggcaagaauuagaagcaguuuggu

 - 41

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; PCR [1]
Predicted targets

References

1
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).