Stem-loop sequence cel-mir-267

AccessionMI0000347 (change log)
DescriptionCaenorhabditis elegans miR-267 stem-loop
Stem-loop
   uaaaa     --       c      u   u      a    a   u 
5'      guuuc  aaaaccc gugaag guc gcugca ucua auu u
        |||||  ||||||| |||||| ||| |||||| |||| |||  
3'      caagg  uuuuggg uacuuc cag ugacgu agau uag u
   augcc     ac       u      u   c      -    a   a 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This precursor sequence was predicted by comparative computational approaches. The excised miRNA sequence is predicted and the precise 5' or 3' end unknown. A PCR amplification protocol confirmed that the strand containing the predicted miR is predominantly expressed.

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 12638134-12638226 [-]
antisense
Y38E10A.18 ; Y38E10A.18; intron 6
Database links

Mature sequence cel-miR-267

Accession MIMAT0000323
Sequence

16 - 

cccgugaagugucugcugca

 - 35

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; PCR [1]
Predicted targets

References

1
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).