Stem-loop sequence cel-mir-266

AccessionMI0000346 (change log)
DescriptionCaenorhabditis elegans miR-266 stem-loop
Gene family MIPF0000281; mir-266
Literature search

1 open access papers mention cel-mir-266
(7 sentences)

Stem-loop
   u u  a  c             a                      a 
5'  g cu aa uugggcaaaaguu ggcaagacuuuggcaaagcuug a
    | || || ||||||||||||| ||||||||||||||||||||||  
3'  c ga uu aacccguuuucaa ccguuuugaaaccguuuugaac u
   a c  c  a             c                      c 
Get sequence
Deep sequencing
2312 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This precursor sequence was predicted by comparative computational approaches. The excised miRNA sequence is predicted and the precise 5' or 3' end unknown. A PCR amplification protocol confirmed that the strand containing the predicted miR is predominantly expressed.

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 3755150-3755243 [+]
intergenic
Database links

Mature sequence cel-miR-266

Accession MIMAT0000322
Sequence

23 - 

aggcaagacuuuggcaaagc

 - 42

Get sequence
Deep sequencing1891 reads, 14 experiments
Evidence experimental; PCR [1], Illumina [2]
Predicted targets

References

1
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).
2