Stem-loop sequence cel-mir-265

AccessionMI0000345 (change log)
DescriptionCaenorhabditis elegans miR-265 stem-loop
Literature search

2 open access papers mention cel-mir-265
(2 sentences)

Stem-loop 
       ug cu    -    -      g ug     ----c    uu 
5' gguu  a  uacc cccu ccuucc c  gccgc     guuu  a
   ||||  |  |||| |||| |||||| |  |||||     ||||  u
3' ccaa  u  augg ggga ggaggg g  uggug     caag  u
       gu -u    u    a      a uu     uaguu    ua
Get sequence
Deep sequencing
13 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This precursor sequence was predicted by comparative computational approaches. The excised miRNA sequence is predicted and the precise 5' or 3' end unknown. A PCR amplification protocol confirmed that the strand containing the predicted miR is predominantly expressed.

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 12740443-12740528 [-]
sense
T23F6.5 ; T23F6.5; intron 1
Database links

Mature sequence cel-miR-265

Accession MIMAT0000321
Sequence

60 -  

ugagggaggaagggugguau

 - 79

Get sequence
Deep sequencing8 reads, 4 experiments
Evidence experimental; PCR [1]
Predicted targets

References

1
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).