Stem-loop sequence cel-mir-264

AccessionMI0000344 (change log)
DescriptionCaenorhabditis elegans miR-264 stem-loop
Stem-loop
   u   gg    -cga    u   --u      a   ug    -   c  u 
5'  ggc  cggu    caug aca   aucacc guc  gcuu uuc cg u
    |||  ||||    |||| |||   |||||| |||  |||| ||| ||  
3'  ccg  gcca    guau ugu   uggugg cgg  cgaa gag gc u
   a   ag    uagg    -   ugu      g   --    c   c  c 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This precursor sequence was predicted by comparative computational approaches. The excised miRNA sequence is predicted and the precise 5' or 3' end unknown. A PCR amplification protocol confirmed that the strand containing the predicted miR is predominantly expressed.

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 2819254-2819346 [+]
intergenic
Database links

Mature sequence cel-miR-264

Accession MIMAT0000320
Sequence

60 - 

ggcgggugguuguuguuaug

 - 79

Get sequence
Evidence experimental; PCR [1]
Predicted targets

References

1
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).