Stem-loop sequence dme-mir-263a

AccessionMI0000343 (change log)
Previous IDsdme-mir-263
DescriptionDrosophila melanogaster miR-263a stem-loop
Gene family MIPF0000122; mir-263
Literature search

10 open access papers mention dme-mir-263a
(170 sentences)

Stem-loop
   uaga     g   a  ua   g     ga   au       guaauu 
5'     ucucg cac gu  aug cacug  aga  ucacggg      u
       ||||| ||| ||  ||| |||||  |||  |||||||      u
3'     agagc gug ua  uac gugau  ucu  agugccc      u
   aaua     -   g  uc   g     uc   --       aacaua 
Get sequence
Deep sequencing
744172 reads, 4.97e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 11953410-11953503 [-]
sense
FBtr0306899 ; CR43314-RD; exon 2
Database links

Mature sequence dme-miR-263a-5p

Accession MIMAT0000319
Previous IDsdme-miR-263a
Sequence

18 - 

aauggcacuggaagaauucacggg

 - 41

Get sequence
Deep sequencing741987 reads, 49 experiments
Evidence experimental; Northern [1], 454 [3-4], Illumina [4]
Database links
Predicted targets

Mature sequence dme-miR-263a-3p

Accession MIMAT0020799
Sequence

59 - 

cgugaucucuuaguggcaucua

 - 80

Get sequence
Deep sequencing2183 reads, 45 experiments
Evidence not experimental
Database links

References

1
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).
2
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).