Stem-loop sequence dme-mir-263a

Accession MI0000343
Previous IDs dme-mir-263
Description Drosophila melanogaster miR-263a stem-loop
Gene family MIPF0000122; mir-263
Stem-loop 
uaga     g   a  ua   g     ga   au       guaauu 
    ucucg cac gu  aug cacug  aga  ucacggg      u
    ||||| ||| ||  ||| |||||  |||  |||||||      u
    agagc gug ua  uac gugau  ucu  agugccc      u
aaua     -   g  uc   g     uc   --       aacaua
Get sequence
Deep sequencing
76269 reads, 50 experiments
Comments

This sequence was computationally predicted by two independent groups based on similarity with C. elegans miR-228 (MI0000303 ) [1] and conservation in D. pseudoobscura [2]. Northern blotting confirmed that the strand containing the predicted miR is predominantly expressed, but the precise 5' or 3' ends are unknown. The sequence was named miR-263 in in reference [1], and maps to chromosome 2L.

Genome context
Coordinates (BDGP5.0) Overlapping transcripts
2L: 11953410-11953503 [-]
sense
FBtr0306899 ; CR43314-RD; exon 2
FBtr0306899 ; CR43314-RD; exon 2

Mature sequence dme-miR-263a-5p

Accession MIMAT0000319
Previous IDs dme-miR-263a
Sequence

15 -  

guuaauggcacuggaagaauucac

 - 38

Get sequence
Deep sequencing 74481 reads, 50 experiments
Evidence experimental; Northern [1], 454 [3-4], Solexa [4]
Predicted targets

Mature sequence dme-miR-263a-3p

Accession MIMAT0020799
Sequence

59 -  

cgugaucucuuaguggcaucua

 - 80

Get sequence
Deep sequencing 1788 reads, 43 experiments
Evidence not experimental
Predicted targets

References

1
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).
2
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).