Stem-loop sequence hsa-mir-200b

AccessionMI0000342 (change log)
Symbol HGNC:MIR200B
DescriptionHomo sapiens miR-200b stem-loop
Gene family MIPF0000019; mir-8
Literature search

680 open access papers mention hsa-mir-200b
(4422 sentences)

Stem-loop
   cca  uc    ag    g c    -    ug     c      u  ag 
5'    gc  gggc  ccgu g cauc uuac  ggcag auugga gg  u
      ||  ||||  |||| | |||| ||||  ||||| |||||| ||  c
3'    cg  cccg  ggcg c guag aaug  ccguc uaaucu cu  a
   gca  -u    -a    g a    u    gu     a      -  gg 
Get sequence
Deep sequencing
1472281 reads, 3.83e+03 reads per million, 156 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 1167104-1167198 [+]
antisense
OTTHUMT00000005064 ; SDF4-001; intron 1
OTTHUMT00000005065 ; SDF4-002; intron 1
OTTHUMT00000005070 ; SDF4-007; intron 1
OTTHUMT00000005068 ; SDF4-005; intron 1
ENST00000360001 ; SDF4-001; intron 1
ENST00000465727 ; SDF4-002; intron 1
ENST00000263741 ; SDF4-007; intron 1
ENST00000459994 ; SDF4-005; intron 1
ENST00000545427 ; SDF4-201; intron 1
Clustered miRNAs
< 10kb from hsa-mir-200b
hsa-mir-200bchr1: 1167104-1167198 [+]
hsa-mir-200achr1: 1167863-1167952 [+]
hsa-mir-429chr1: 1169005-1169087 [+]
Database links

Mature sequence hsa-miR-200b-5p

Accession MIMAT0004571
Previous IDshsa-miR-200b*
Sequence

21 - 

caucuuacugggcagcauugga

 - 42

Get sequence
Deep sequencing26658 reads, 120 experiments
Evidence experimental; cloned [4]
Database links
Predicted targets

Mature sequence hsa-miR-200b-3p

Accession MIMAT0000318
Previous IDshsa-miR-200b
Sequence

57 - 

uaauacugccugguaaugauga

 - 78

Get sequence
Deep sequencing1445603 reads, 157 experiments
Evidence experimental; Northern [1], cloned [2-5]
Database links
Predicted targets

References

1
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).