Stem-loop sequence cel-mir-261

AccessionMI0000338 (change log)
DescriptionCaenorhabditis elegans miR-261 stem-loop
Stem-loop
   ----------------------------------------------ugaug    ------     g  u  uu 
5'                                                    gcuu      uucug au ug  c
                                                      ||||      ||||| || ||  c
3'                                                    cgag      aagau ug ac  c
   uuauagguauaaguggcacuuuugauuuuucgauugugauucuaaaaaaaa    caaaga     g  c  uu 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 5969058-5969156 [+]
intergenic
Database links

Mature sequence cel-miR-261

Accession MIMAT0000316
Sequence

66 - 

uagcuuuuuaguuuucacg

 - 84

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).