Stem-loop sequence cel-mir-256

AccessionMI0000333 (change log)
DescriptionCaenorhabditis elegans miR-256 stem-loop
Literature search

1 open access papers mention cel-mir-256
(2 sentences)

Stem-loop
   -------gcaag        agg   a     agacgg   aga    cc    u 
5'             gagugcag   cuu cuaug      uca   ggcg  uccg c
               ||||||||   ||| |||||      |||   ||||  |||| a
3'             cucauguc   gaa gauac      ggu   cugc  aggu c
   cauuuuaaaaaa        --a   -     --guaa   ggg    au    g 
Get sequence
Deep sequencing
93 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrV: 6956043-6956143 [-]
intergenic
Database links

Mature sequence cel-miR-256

Accession MIMAT0000311
Sequence

66 - 

uggaaugcauagaagacugua

 - 86

Get sequence
Deep sequencing90 reads, 9 experiments
Evidence experimental; Northern [2]
Predicted targets

References

1
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).