Stem-loop sequence cel-mir-255

AccessionMI0000331 (change log)
DescriptionCaenorhabditis elegans miR-255 stem-loop
Gene family MIPF0000368; mir-255
Literature search

1 open access papers mention cel-mir-255
(1 sentences)

Stem-loop
      ug  -ucgac       -     ---             g     c  -   au 
5' cag  gu      uaaauuu uggag   guaagaaaucuuu uaguu uc cgu  u
   |||  ||      ||||||| |||||   ||||||||||||| ||||| || |||   
3' guc  ua      guuuaaa acuuc   cauuuuuuagaga gucaa ag gca  g
      cu  uauaaa       c     aga             a     a  u   gu 
Get sequence
Deep sequencing
4909 reads, 35.3 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This precursor sequence was identified computationally using sequence homology with C. briggsae [1]. The mature microRNA was identified later [2].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrV: 5440639-5440748 [+]
intergenic
Database links

Mature sequence cel-miR-255-5p

Accession MIMAT0020341
Previous IDscel-miR-255*
Sequence

25 - 

guaagaaaucuuuguaguucuc

 - 46

Get sequence
Deep sequencing29 reads, 8 experiments
Evidence experimental; Illumina [5]

Mature sequence cel-miR-255-3p

Accession MIMAT0004216
Previous IDscel-miR-255
Sequence

62 - 

aaacugaagagauuuuuuacag

 - 83

Get sequence
Deep sequencing4869 reads, 17 experiments
Evidence experimental; cloned [2], Illumina [3,5], CLIPseq [4]
Database links
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3
4
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
5