Stem-loop sequence cel-mir-254

AccessionMI0000330 (change log)
DescriptionCaenorhabditis elegans miR-254 stem-loop
Gene family MIPF0000310; mir-254
Literature search

3 open access papers mention cel-mir-254
(12 sentences)

Stem-loop
   --acua     -a             aa  -au      c       - au 
5'       ugcau  uugccgccuacag  gc   agauuu cacaaac c  u
         |||||  |||||||||||||  ||   |||||| ||||||| |  c
3'       acgua  agcggcggauguc  cg   ucuaaa guguuug g  g
   uuuuug     ca             ag  cuu      c       u ga 
Get sequence
Deep sequencing
9941 reads, 17.6 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 11333531-11333630 [-]
sense
ZK455.2 ; ZK455.2; intron 20
Database links

Mature sequence cel-miR-254-5p

Accession MIMAT0031891
Sequence

19 - 

uacagaagcauagauuuccaca

 - 40

Get sequence
Deep sequencing31 reads, 11 experiments
Evidence experimental; 454 [2]
Database links

Mature sequence cel-miR-254-3p

Accession MIMAT0000310
Previous IDscel-miR-254
Sequence

59 - 

ugcaaaucuuucgcgac

 - 75

Get sequence
Deep sequencing9908 reads, 17 experiments
Evidence experimental; Northern [1-2], PCR [1], Illumina [3]
Database links
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3