Stem-loop sequence cel-mir-253

AccessionMI0000329 (change log)
DescriptionCaenorhabditis elegans miR-253 stem-loop
Gene family MIPF0000286; mir-253
Stem-loop
   -----  auu    - ga           uu    - a   c       -   ac  c 
5'      ga   guuc c  ucgccgcucuu  caca c ccu acuaaca cug  ca c
        ||   |||| |  |||||||||||  |||| | ||| ||||||| |||  ||  
3'      cu   caag g  agcggcgggaa  gugu g gga ugauugu gau  gu g
   cuuug  --g    u ac           gg    u c   -       a   ac  a 
Get sequence
Deep sequencing
243583 reads, 671 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

A mature miRNA product from the 5' arm of this hairpin precursor was first identified [1]. A later large scale cloning and sequencing study identified a 3' product and showed it to be the dominant mature miRNA [2].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrV: 5780510-5780616 [-]
sense
F44E7.5a ; F44E7.5a; intron 1
F44E7.5b ; F44E7.5b; intron 1
antisense
F44E7.15 ; F44E7.15; exon 1
Database links

Mature sequence cel-miR-253-5p

Accession MIMAT0000309
Previous IDscel-miR-253;cel-miR-253*
Sequence

21 - 

cuuuucacacaccucacuaaca

 - 42

Get sequence
Deep sequencing270 reads, 11 experiments
Evidence experimental; Northern [1], PCR [1], CLIPseq [4], Illumina [5]
Database links
Predicted targets

Mature sequence cel-miR-253-3p

Accession MIMAT0004215
Previous IDscel-miR-253
Sequence

64 - 

uuaguaggcguugugggaaggg

 - 85

Get sequence
Deep sequencing243136 reads, 17 experiments
Evidence experimental; cloned [2], Illumina [3,5], CLIPseq [4]
Database links
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3
4
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
5