Stem-loop sequence cel-mir-252

AccessionMI0000328 (change log)
DescriptionCaenorhabditis elegans miR-252 stem-loop
Gene family MIPF0000285; mir-252
Literature search

2 open access papers mention cel-mir-252
(47 sentences)

Stem-loop
   uccaggg   --uc        a       u  u  c c      cc   agu 
5'        guc    uuucaguu uaaguag ag gc g agguaa  gcc   c
          |||    |||||||| ||||||| || || | ||||||  |||   u
3'        uag    aaaguuaa auucguc uc cg c uccauu  cgg   a
   ------g   uuau        a       u  -  u a      --   aaa 
Get sequence
Deep sequencing
96764 reads, 394 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [2].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 11446863-11446960 [-]
antisense
W02B12.17 ; W02B12.17; exon 1
W02B12.13a ; W02B12.13a; intron 4
W02B12.13b ; W02B12.13b; intron 4
Database links

Mature sequence cel-miR-252-5p

Accession MIMAT0000308
Previous IDscel-miR-252
Sequence

21 - 

auaaguaguagugccgcagguaa

 - 43

Get sequence
Deep sequencing96624 reads, 17 experiments
Evidence experimental; Northern [1-2], PCR [1], Illumina [3,5], CLIPseq [4]
Database links
Predicted targets

Mature sequence cel-miR-252-3p

Accession MIMAT0020340
Previous IDscel-miR-252*
Sequence

60 - 

cuuaccuacugccuucugc

 - 78

Get sequence
Deep sequencing134 reads, 13 experiments
Evidence experimental; Illumina [5]
Database links

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3
4
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
5