Stem-loop sequence cel-mir-251

AccessionMI0000327 (change log)
DescriptionCaenorhabditis elegans miR-251 stem-loop
Gene family MIPF0000284; mir-251
Literature search

2 open access papers mention cel-mir-251
(47 sentences)

Stem-loop
   -ac      ugac -     u          u  cg         gg  g 
5'    uuucaa    c ccuug uaaguagugg gc  cucuuauua  uu a
      ||||||    | ||||| |||||||||| ||  |||||||||  ||  
3'    aaaguu    g ggaac auucaucacu ug  gagaauaau  ga a
   uuu      uaaa u     u          -  au         --  a 
Get sequence
Deep sequencing
1984 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 11004728-11004824 [+]
intergenic
Database links

Mature sequence cel-miR-251

Accession MIMAT0000307
Sequence

19 - 

uuaaguaguggugccgcucuua

 - 40

Get sequence
Deep sequencing1970 reads, 14 experiments
Evidence experimental; Northern [1-2], PCR [1], Illumina [3], CLIPseq [4]
Database links
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3
4
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).