Stem-loop sequence cel-mir-250

AccessionMI0000326 (change log)
DescriptionCaenorhabditis elegans miR-250 stem-loop
Gene family MIPF0000283; mir-250
Literature search

1 open access papers mention cel-mir-250
(1 sentences)

Stem-loop
   ----a    cuuc g    c   uu      c  c     c  -   aaca 
5'      gggu    g acca gcc  caguug cu gugau cg cca    c
        ||||    | |||| |||  |||||| || ||||| || |||    a
3'      ccca    c uggu cgg  gucaac ga cacua gc ggu    a
   uuuua    ugcu g    a   uu      u  -     a  a   aaau 
Get sequence
Deep sequencing
498312 reads, 3.24e+03 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [2].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrV: 11769917-11770015 [-]
intergenic
Clustered miRNAs
< 10kb from cel-mir-250
cel-mir-61chrV: 11770060-11770156 [-]
cel-mir-250chrV: 11769917-11770015 [-]
Database links

Mature sequence cel-miR-250-5p

Accession MIMAT0020339
Previous IDscel-miR-250*
Sequence

18 - 

ccuucaguugccucgugauccg

 - 39

Get sequence
Deep sequencing1610 reads, 16 experiments
Evidence experimental; Illumina [5]
Database links

Mature sequence cel-miR-250-3p

Accession MIMAT0000306
Previous IDscel-miR-250
Sequence

60 - 

aaucacagucaacuguuggc

 - 79

Get sequence
Deep sequencing496648 reads, 17 experiments
Evidence experimental; Northern [1-2], PCR [1], Illumina [3,5], CLIPseq [4]
Database links
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3
4
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
5