Stem-loop sequence cel-mir-247

AccessionMI0000323 (change log)
DescriptionCaenorhabditis elegans miR-247 stem-loop
Gene family MIPF0001019; mir-247
Literature search

1 open access papers mention cel-mir-247
(4 sentences)

Stem-loop
   auuacca        -     u      a  u     a     cau   gc 
5'        gcuauuuu ccaag agagaa ag uucua uuacc   cau  a
          |||||||| ||||| |||||| || ||||| |||||   |||   
3'        cggugaaa gguuc ucucuu uc gagau agugg   gua  c
   ---ucag        a     u      a  c     c     --u   aa 
Get sequence
Deep sequencing
64 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [2].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 4756971-4757068 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-247
cel-mir-247chrX: 4756971-4757068 [+]
cel-mir-797chrX: 4757109-4757197 [+]
Database links

Mature sequence cel-miR-247-5p

Accession MIMAT0015119
Previous IDscel-miR-247*
Sequence

21 - 

uagagaaaaguuucuaauuacc

 - 42

Get sequence
Deep sequencing17 reads, 6 experiments
Evidence experimental; CLIPseq [4]
Database links
Predicted targets

Mature sequence cel-miR-247-3p

Accession MIMAT0000303
Previous IDscel-miR-247
Sequence

61 - 

ugacuagagccuauucucuucu

 - 82

Get sequence
Deep sequencing47 reads, 10 experiments
Evidence experimental; cloned [1-2], Northern [1], Illumina [3], CLIPseq [4]
Database links
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3
4
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).