Stem-loop sequence cel-mir-246

AccessionMI0000322 (change log)
DescriptionCaenorhabditis elegans miR-246 stem-loop
Gene family MIPF0000260; mir-246
Literature search

6 open access papers mention cel-mir-246
(37 sentences)

Stem-loop
   a  ug  uuauaa    u g    a   uugu           uccca 
5'  uc  aa      aaca c ccua ccg    cauguaauauu     g
    ||  ||      |||| | |||| |||    |||||||||||     a
3'  ag  uu      uugu g ggau ggc    guacauuauag     g
   c  gu  -caaac    c a    g   -uuu           uaaaa 
Get sequence
Deep sequencing
53138 reads, 346 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [2].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 10940134-10940230 [+]
intergenic
Database links

Mature sequence cel-miR-246-5p

Accession MIMAT0020337
Previous IDscel-miR-246*
Sequence

19 - 

cgccuaaccguugucauguaaua

 - 41

Get sequence
Deep sequencing163 reads, 10 experiments
Evidence experimental; Illumina [5]
Database links

Mature sequence cel-miR-246-3p

Accession MIMAT0000302
Previous IDscel-miR-246
Sequence

61 - 

uuacauguuucggguaggagc

 - 81

Get sequence
Deep sequencing52972 reads, 13 experiments
Evidence experimental; cloned [1-2], Northern [1], Illumina [3,5], CLIPseq [4]
Database links
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3
4
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
5