Stem-loop sequence cel-mir-244

AccessionMI0000320 (change log)
DescriptionCaenorhabditis elegans miR-244 stem-loop
Gene family MIPF0000256; mir-244
Literature search

1 open access papers mention cel-mir-244
(3 sentences)

Stem-loop
   ------  c  -u        cu         uac    ug     -   cau 
5'       cu ca  aucucaau  cuuugguug   aaag  guaug gcu   c
         || ||  ||||||||  |||||||||   ||||  ||||| |||   g
3'       ga gu  uagaguua  gaaaucgac   uuuc  cauac cga   a
   uuuucg  u  uu        ag         --u    gu     a   aua 
Get sequence
Deep sequencing
9325 reads, 219 reads per million, 16 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 4684316-4684414 [-]
intergenic
Database links

Mature sequence cel-miR-244-5p

Accession MIMAT0000300
Previous IDscel-miR-244
Sequence

16 - 

ucuuugguuguacaaagugguaug

 - 39

Get sequence
Deep sequencing9231 reads, 16 experiments
Evidence experimental; cloned [1-2], Northern [1], Illumina [3], CLIPseq [4]
Database links
Predicted targets

Mature sequence cel-miR-244-3p

Accession MIMAT0015118
Previous IDscel-miR-244*
Sequence

58 - 

uacugcuuuucagcuaaagga

 - 78

Get sequence
Deep sequencing85 reads, 13 experiments
Evidence experimental; CLIPseq [4]
Database links
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3
4
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).