Stem-loop sequence cel-mir-243

AccessionMI0000319 (change log)
DescriptionCaenorhabditis elegans miR-243 stem-loop
Literature search

4 open access papers mention cel-mir-243
(56 sentences)

Stem-loop
   --ugu     cauaa             g               -  gcuc 
5'      ucacg     gccugauaucucg ugcgaucguaccgua uc    a
        |||||     ||||||||||||| ||||||||||||||| ||    c
3'      agugc     uggacuauagggc gcgcuagcauggcau ag    a
   agguu     ----a             g               u  auuc 
Get sequence
Deep sequencing
72428 reads, 159 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 4450779-4450876 [+]
sense
R08C7.12b ; R08C7.12b; intron 1
Database links

Mature sequence cel-miR-243-5p

Accession MIMAT0015117
Previous IDscel-miR-243*
Sequence

20 - 

uaucucggugcgaucguac

 - 38

Get sequence
Deep sequencing1503 reads, 11 experiments
Evidence experimental; CLIPseq [4]
Database links
Predicted targets

Mature sequence cel-miR-243-3p

Accession MIMAT0000299
Previous IDscel-miR-243
Sequence

61 - 

cgguacgaucgcggcgggauauc

 - 83

Get sequence
Deep sequencing70922 reads, 17 experiments
Evidence experimental; cloned [1-2], Northern [1], Illumina [3], CLIPseq [4]
Database links
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3
4
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).