Stem-loop sequence cel-mir-242

AccessionMI0000318 (change log)
DescriptionCaenorhabditis elegans miR-242 stem-loop
Gene family MIPF0000366; mir-242
Stem-loop
   ---------     c c      a     u   ccu     u    -a   a 
5'          uggcu g gagagu uugcg agg   uugcu cgag  gag a
            ||||| | |||||| ||||| |||   ||||| ||||  |||  
3'          aucgg c cuuuca aacgc ucc   aacga gcuu  cuu g
   aaaaaacgu     c c      a     c   uau     c    ga   c 
Get sequence
Deep sequencing
2742 reads, 5.88 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 4274247-4274342 [+]
intergenic
Database links

Mature sequence cel-miR-242

Accession MIMAT0000298
Sequence

16 - 

uugcguaggccuuugcuucga

 - 36

Get sequence
Deep sequencing2728 reads, 17 experiments
Evidence experimental; cloned [1-2], Northern [1], Illumina [3], CLIPseq [4]
Database links
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3
4
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).