Stem-loop sequence cel-mir-241

AccessionMI0000317 (change log)
DescriptionCaenorhabditis elegans miR-241 stem-loop
Gene family MIPF0000248; mir-241
Literature search

27 open access papers mention cel-mir-241
(121 sentences)

Stem-loop
   --c  gg      a  u        g  c    -     -   cau ca 
5'    gg  guguca ag ugagguag ug gaga aauga cgg   c  u
      ||  |||||| || |||||||| || |||| ||||| |||   |   
3'    uc  uacagu uc acuucguc ac cucu uuacu gcu   g  a
   gca  gg      g  u        g  u    g     u   aau au 
Get sequence
Deep sequencing
490480 reads, 1.58e+03 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrV: 14366188-14366283 [-]
intergenic
Clustered miRNAs
< 10kb from cel-mir-241
cel-mir-241chrV: 14366188-14366283 [-]
cel-mir-48chrV: 14364412-14364509 [-]
Database links

Mature sequence cel-miR-241-5p

Accession MIMAT0000297
Previous IDscel-miR-241
Sequence

16 - 

ugagguaggugcgagaaauga

 - 36

Get sequence
Deep sequencing489119 reads, 15 experiments
Evidence experimental; cloned [1-2], Northern [1], Illumina [3,5], CLIPseq [4]
Database links
Predicted targets

Mature sequence cel-miR-241-3p

Accession MIMAT0020335
Previous IDscel-miR-241*
Sequence

60 - 

auugucucucagcugcuucauc

 - 81

Get sequence
Deep sequencing1279 reads, 12 experiments
Evidence experimental; Illumina [5]
Database links

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3
4
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
5