Stem-loop sequence cel-mir-240

AccessionMI0000316 (change log)
DescriptionCaenorhabditis elegans miR-240 stem-loop
Gene family MIPF0000243; mir-240
Literature search

7 open access papers mention cel-mir-240
(29 sentences)

Stem-loop
   uuguua   -acuu    a  u         u a a    a     ugaa 
5'       gaa     uuuc aa cgaggauuu g g cuag augcu    u
         |||     |||| || ||||||||| | | |||| |||||    u
3'       cuu     aaag uu gcuucuaaa c c gguc uacga    g
   -----a   gacau    a  c         c c c    a     ucau 
Get sequence
Deep sequencing
22151 reads, 71.4 reads per million, 14 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 7882622-7882718 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-240
cel-mir-240chrX: 7882622-7882718 [+]
cel-mir-786chrX: 7882751-7882840 [+]
cel-mir-8203chrX: 7882764-7882824 [-]
Database links

Mature sequence cel-miR-240-5p

Accession MIMAT0015116
Previous IDscel-miR-240*
Sequence

22 - 

cgaggauuuugagacuagaaugc

 - 44

Get sequence
Deep sequencing10607 reads, 12 experiments
Evidence experimental; CLIPseq [4], Illumina [5]
Database links
Predicted targets

Mature sequence cel-miR-240-3p

Accession MIMAT0000296
Previous IDscel-miR-240
Sequence

61 - 

uacuggcccccaaaucuucgcu

 - 82

Get sequence
Deep sequencing11544 reads, 14 experiments
Evidence experimental; cloned [1-2], Northern [1], Illumina [3,5], CLIPseq [4]
Database links
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3
4
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
5