Stem-loop sequence cel-mir-239b

Accession MI0000315
Description Caenorhabditis elegans miR-239b stem-loop
Gene family MIPF0000135; mir-239
Stem-loop 
--------     aga   a          ua         a   -   a  ua 
        gcgac   ugc auuuuuguac  cacaaaagu cug guc uu  a
        |||||   ||| ||||||||||  ||||||||| ||| ||| ||   
        cguug   acg uaaaaacgug  guguuuuca gac cgg ag  g
ucuauuuu     --a   g          ug         c   u   -  uu
Get sequence
Deep sequencing
815 reads, 5 experiments
Comments

miR-239b was predicted by computational analysis and conservation in C. elegans and C. briggsae, and the microRNA confirmed by PCR amplification, cloning and sequencing [1]. A large scale cloning and sequencing study finds two dominant mature miRNA products: the second is 1 nt shorter at the 5' end [3].

Genome context
Coordinates (WBcel215) Overlapping transcripts
X: 11791235-11791332 [-]
intergenic
Clustered miRNAs
< 10kb from cel-mir-239b
cel-mir-239a X: 11792378-11792475 [+]
cel-mir-239b X: 11791235-11791332 [-]
Database links

Mature sequence cel-miR-239b-5p

Accession MIMAT0000295
Previous IDs cel-miR-239b
Sequence

16 -  

uuuguacuacacaaaaguacug

 - 37

Get sequence
Deep sequencing 281 reads, 5 experiments
Evidence experimental; cloned [3], Solexa [4], CLIPseq [5]
Validated targets
Predicted targets

Mature sequence cel-miR-239b-3p

Accession MIMAT0015115
Previous IDs cel-miR-239b*
Sequence

58 -  

gcacuuuuguggugugcaaaaa

 - 79

Get sequence
Deep sequencing 525 reads, 5 experiments
Evidence experimental; CLIPseq [5]
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:15317971 "Patterns of flanking sequence conservation and a characteristic upstream motif for microRNA gene identification" Ohler U, Yekta S, Lim LP, Bartel DP, Burge CB RNA. 10:1309-1322(2004).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).